Welcome to the Tol2kit blog
This is a forum for discussing the Tol2kit; the Lawson lab's related system; and related topics.
The Tol2kit is a set of constructs that can be used with Invitrogen's multisite Gateway recombination-based cloning system to build expression constructs in a Tol2 transposon backbone (derived from constructs from the Kawakami lab).
At present each post serves as a topic under which visitors may post comments, either commenting or asking questions. We encourage you to post with your full name (not just your first name) so that we have some idea who is asking.
30 October 2007: There has been a fair amount of spam recently, so I have turned on word verification for comments. You will have to do a "word recognition" task before you can post a comment. Please email me directly if you have any problems with this. --Chi-Bin
The Tol2kit is a set of constructs that can be used with Invitrogen's multisite Gateway recombination-based cloning system to build expression constructs in a Tol2 transposon backbone (derived from constructs from the Kawakami lab).
At present each post serves as a topic under which visitors may post comments, either commenting or asking questions. We encourage you to post with your full name (not just your first name) so that we have some idea who is asking.
30 October 2007: There has been a fair amount of spam recently, so I have turned on word verification for comments. You will have to do a "word recognition" task before you can post a comment. Please email me directly if you have any problems with this. --Chi-Bin
Thursday, June 14, 2007
Questions about the Tol2kit, 6/15/07-8/29/07
Ask general questions about the Tol2kit system by commenting on this post; we will do our best to answer in a timely manner. This posting covers questions from 6/15/07-8/29/07.
Subscribe to:
Post Comments (Atom)
24 comments:
Kristen and Chi-Bin,
Re Seok-Yong's comment from June 7, I sequenced our pME-mCherry-CAAX and found the same substitution mentioned. I have also been unable to get this reporter to work in my hands, even under the control of promoters that I've had give strong EGFP-CAAX expression. I wanted to check to see what the progress was on this plasmid in your lab, and if it's not high on your priority list (which I understand!), I'd be interested in talking to you about how you made the construct in the first place so I could perhaps repeat the process or otherwise fix the current plasmid. Let me know. Thank you for all your terrific work!
Margaret,
As indicated in my response to Seok-Yong, apparently our original mCherry-CAAX miniprep ( which we sequenced) was a mixture of two clones, one correct and one with the H80D point mutant. The maxiprep that we grew for distribution retained the point mutation, but the functional tests that we did ourselves (which gave fluorescence) used the miniprep. So, while expression clones made with the middle clone miniprep gave red fluorescence, we can't say for sure whether these clones had the point mutation or not. We are going to go back and sequence our expression clone to look for H80D.
Note that mCherry-CAAX is the dimmest of the mCherry variants that we made, and also note that mCherry is pretty dim and hard to see to start with. Have you ever done anything with mCherry or nls-mCherry? I'm trying to distinguish between the possibilities that (a) mCherry-CAAX doesn't work, or (b) you haven't tried the right filters to see mCherry.
If anyone else (Seok-Yong?) has experience with pME-mCherry-CAAX, we'd love to hear about it.
As described on the page for this clone, it was made by PCR. We could either pick new colonies from the miniprep to find ones without H80D, or it would be easy to fix the mutation using QuikChange.
Another option, since the mutation is in the 5' end of the ORF, would be to just move the 3' end with the CAAX sequence into pME-mCherry (which lacks the mutation) using the unique PstI and EcoRV sites found in both plasmids. This is pretty straightforward cloning and could be done by individual labs without your having to distribute any new plasmids to those who already have the kit.
-jim
Dear Chi-Bin,
I'm working on correcting the H80D mutation using the same method suggested by Jim. I will try both constructs (wild type and H80D) out in embryos and let you know how it goes. Thanks. SY
Thanks a lot Seok-Yong. In the meantime, we'll go back and check a couple of sequences on our end.
Seok-Yong, is it right that you haven't yet tested any expression clones made with pME-mCherry-CAAX?
Margaret and Seok-Yong, do either of you have experience imaging any form of mCherry (e.g. cytoplasmic or nuclear)? Note that mCherry-CAAX will likely be dimmer, so there may be detection problems.
Dear Chi-Bin,
Right, I haven't yet tested the construct I generated with pME-mCherry-CAAX. Given the crystal structure, I figured H80 could be important for formation of fluorophore. So I decided to make a corrected version first and then compare their efficiency.
Yes, I have experience with imaging mCherry.
BTW, I noticed that your p3E-IRES-EGFPpA plasmid has 7 As (adenine) in the A6 bifurcation loop. I think removing 1 A (resulting in 6 As) might increase the expression level. Thanks. SY
Dear Seok-Yong,
Thanks a lot for testing the two mCherry-CAAX versions. We'll let you know if we learn anything on our end. Who are you actually? Your Blogger identity doesn't give your last name, and I want to know to whom we should be grateful.
About the IRES, it sounds like you know more about IRESes than we do. Do you mean the seven As in the following context?
...TTTAGTCGAGGTTAAAAAAACGTCTAGGCCCC...
Can you give me a reference for why you think six As would be better? If it makes sense, we'd be happy to try using QuikChange to remake this.
Chi-Bin
Hi Chi-Bin,
I'm a post-doc in the Ajay Chitnis lab at the NIH. My last name is Choi.
Re IRES, yes that's right. That's the 7 As I'm talking about.
I don't know much about IRES, yet I learned the importance of the A6 bifurcation loop from the following paper:
Bochkov YA, Palmenberg AC.
Biotechniques. 2006 Sep;41(3):283
Translational efficiency of EMCV IRES in bicistronic vectors is dependent upon IRES sequence and gene location.
Removing 1 A is just a guess though. I can't guarantee it would increase expression.
Thanks. SY
You might be interested in Figure 2 in the paper. You can see the difference in expression between 6A and 7A. SY
Dear Margaret and Seok-Yong,
Three data:
1) We have gone back and sequenced the maxiprep of pME-mCherryCAAX that we distributed, and indeed it has the H80D mutation. Sorry that slipped past us.
2) The test expression constructs that Kristen had built using the miniprep of pME-mCherryCAAX that gave fluorescence, do *not* have H80D.
3) We just heard from Gage Crump that he built beta-actin:mCherryCAAX-IRES-nlsEGFP, and found that GFP fluorescence was quite bright and mCherry was very dim, although visible.
So it seems likely that, indeed, the H80D mutation decreases the brightness of mCherryCAAX.
Chi-Bin
Chi-Bin,
Thanks so much for your comments, advice, and everything. I don't have any experience imaging mCherry -- I'm talking to our scope rep to get optimal filters and to another lab here at the UW to get functional mCherry constructs to make sure we can actually see mCherry expression (even dim expression) on our scopes. I sequenced the pME-nlsmCherry construct to see if I might use that instead, and found another potential missense mutation: H30R (CAC -> CGC). I'm obviously not the person to make any predictions on the effect of that change! (And that sequence, while clean, was only one sequence -- I wouldn't swear it's accurate.)
An edit to my previous comment ... The H30R change is in relation to the mCherry-CAAX construct (the sequence I already had in the computer when I was looking at the nlsmCherry sequence). The sequence I got for nlsmCherry matches the sequence you give for that component. Sorry for the mistake!
Margaret,
Yes, there is an H30R mutation in pME-nls-mCherry, which we know about; however, this construct has definitely been verified to be functional (see the info page for this clone).
However, pME-mCherry does NOT have any missense mutations.
Sequencing Primer
What is the best way to sequence the Tol2 destination vector after recombination? If I saw it right the M13 primers are there twice and can not be used. Did you ever test primers in the recombination sites (B1 – B4)? The sequence from Invitrogen for the sites seems not always to be correct.
Christoph --
Sorry for the delay in responding -- we tend not to sequence the final product after multisite recombination, since no PCR was performed in this step. Diagnostic digests have been sufficient for us.
If you do need to sequence your completed expression construct, our best bet is for you to make sequence specific primers. For example, if you want to make sure your gene of interest recombined correctly, you can make primers to read downstream of your promoter and upstream of your 3' insert to sequence the middle portion. I hope that makes sense. We haven't tried to make primers specific to the Att sites, but that should work as well.
Hi,
Just wondering if anyone has tried, or if it is even possible, to use a BP reaction to change the 3' module of an expression clone (i.e. make a single-site Gateway vector, then put a different 3' entry clone in). I know it is possible to do this with the 5' and middle portions but Vector NTI is telling me I can't do this at the 3' end, at least not with pDONRP2R-P3 (It allows the BP reactions with P4-P1R and P1-P2). Or should it work and the issue is actually with Vector NTI? (It wouldn't be the first time!)
Thanks for any feedback,
jim
Virtual multisite gateway cloning is possible in Vector NTI, yet only in the latest version, which is not running in Tiger. So whenever I want to do the virtual multisite gateway cloning, I have to use PC.
I have just found that Ape can do this cloning both in Mac and PC, with less steps than Vector NTI. It's just like magic.
You can download Ape from the following web page:
http://www.biology.utah.edu/jorgensen/wayned/ape/
Happy virtual cloning!
Hello,
I'm a new postdoc at UTSW. I'm having some trouble with an LR reaction. I have a good number of colonies after plating. There are large and small colonies, the small ones seem to be less opaque than the larger ones, but I wouldn't call them clear. The major problem though is that few of the colonies then grow in culture and the ones that do grow slowly and no plasmid can be recovered. I was wondering if you can encountered this sort of trouble and if you had any suggestions. I see the Gateway manual suggests incubating at 30C or using a different cell line.
Thanks!
Hi Stefanie --
We haven't seen these kinds of problems, really -- to be honest, though, there are generally issues with satellite colonies after these LR reactions, so I tend to be really careful about how long I incubate the plates. It's possible that your smaller colonies are actually satellites; that would explain why they don't grow in culture. I tend not to plate the transformation until sometime late in the afternoon, and then I pull the plates out of the incubator first thing the next morning. With the constructs we've made, there tends not to be a big size difference between the clear and opaque colonies.
In terms of incubating the plates at 30 degrees, we haven't generally done that, although for one particularly big construct (we have a promoter that is 17 kb and tends to undergo self-recombination independently of the Gateway reaction), we do grow that one at room temperature. I don't have an obvious reason why not to try growing your transformation at 30 degrees, particularly if you're working with something very large.
Have you tried doing a control reaction, for example, bactin2:EGFP-polyA?
Hope this is helpful,
Kristen
Hello,
I am just adapting to the gateway system and i've been having trouble with the LR reaction (No colonies!) I have prepared my dnas using the eppendorf mini kit, and I see that the qiagen mini kit is recommended. Could this be my challenge?
Thanks,
Angie
Two questions:
1. Why your attB2 sequence is completely different compared to the sequence from invitrogen manual?
2. If I want to use pDONRP4-P1R to create new entry vector, should my reverse primer has a attB14 sequence or attB1 is ok?
Storm:
> 1. Why your attB2 sequence is completely different > compared to the sequence from invitrogen manual?
It's not totally different. However, there are two slightly different attB2 sequences in the manual:
GGGGACAGCTTTCTTGTACAAAGTGG
(p.15/PDF page 25), for designing attB2 primers to make entry clones
ACCCAGCTTTCTTGTACAAAGTGG
(p.33/PDF page 43), which is the attB2 sequence left in the final expression clone
> 2. If I want to use pDONRP4-P1R to create new
> entry vector, should my reverse primer has a
> attB14 [typo for attB1R--CBC] sequence or attB1
> is ok?
As it says in the Gateway manual, you need to use attB1R.
Just wanted to let everyone know that I believe that the Lawson lab construct #366 (pTolCherryDest) also has the H30R mutation found earlier in pME-nlsmCherry. I've recently used it as a PCR template and my sequenced product has the H30R mutation.
-Barb in Oregon
Post a Comment